Back to index

python-biopython  1.60
Public Member Functions | Public Attributes
Bio.Search.Hit Class Reference

List of all members.

Public Member Functions

def __init__
def __len__

Public Attributes

 name
 description
 accession
 length
 algorithm
 hsps

Detailed Description

Definition at line 44 of file Search.py.


Constructor & Destructor Documentation

def Bio.Search.Hit.__init__ (   self,
  name,
  description,
  accession,
  length,
  algorithm,
  hsps = None 
)

Definition at line 46 of file Search.py.

00046 
00047                  algorithm, hsps = None):
00048         self.name = name
00049         self.description = description
00050         self.accession = accession
00051         self.length = length
00052         self.algorithm = algorithm
00053         if hsps is None:
00054             hsps = []
00055         self.hsps = hsps


Member Function Documentation

def Bio.Search.Hit.__len__ (   self)

Definition at line 56 of file Search.py.

00056 
00057     def __len__(self):
00058         return self.length
00059 
00060 
00061 
00062 # >GB_PL:ATF18F4 AL021637 Arabidopsis thaliana DNA chromosome 4, BAC clone 
00063 #           F18F4 (ESSAII project). 2/98
00064 #             Length = 93,646
00065 #  
00066 #   Minus Strand HSPs:
00067 #  
00068 #  Score = 226 (33.9 bits), Expect = 0.80, P = 0.55
00069 #  Identities = 98/142 (69%), Positives = 98/142 (69%), Strand = Minus / Plus
00070 #    [...lines deleted...]
00071 # Query:  2486 ATATCAAGCAATTTGATAAGATCTAG 2461
00072 #              A AT  A C ATT GA AAGATC AG
00073 # Sbjct: 85387 AGATTTACCTATT-GAGAAGATCAAG 85411
00074 
# computed from the strings

Member Data Documentation

Definition at line 49 of file Search.py.

Definition at line 51 of file Search.py.

Definition at line 48 of file Search.py.

Definition at line 54 of file Search.py.

Definition at line 50 of file Search.py.

Definition at line 47 of file Search.py.


The documentation for this class was generated from the following file: